| Home | E-Submission | Sitemap | Editorial Office
top_img
Korean Journal of Otorhinolaryngology-Head and Neck Surgery > Volume 42(3); 1999 > Article
Korean Journal of Otorhinolaryngology-Head and Neck Surgery 1999;42(3): 317-321.
Comparison of Mucin and Lysozyme Expression between Human in vivo Nasal Epithelial Cells and Cultured Nasal Epithelial Cells.
Joo Heon Yoon, Kyung Su Kim, Sung Shik Kim, Jae Won Kim, Jeung Gweon Lee, In Yong Park
Department of Otorhinolaryngology, Yonsei University College of Medicine, Seuol, Korea. jhyoon@yumc.yonsei.ac.kr
조직생검된 사람 정상 코점막 상피세포와 배양된 코점막 상피세포에서 점액과 리소자임 단백질의 정량 및 유전자 발현 비교
윤주헌 · 김경수 · 김성식 · 김재원 · 이정권 · 박인용
연세대학교 의과대학 이비인후과학교실
주제어: 점액유전자리소자임 유전자사람 코점막 상피세포.
ABSTRACT
BACKGROUND AND OBJECTIVES:
The purpose of this study was to compare the expression of mucin and lysozyme in passage-2 normal human nasal epithelial (NHNE) cells with those in human in vivo nasal epithelium and human tracheal RNA.
MATERIALS AND METHODS:
Cell lysates and total RNA from passage-2 NHNE cells, and human in vivo nasal epithelial cells were obtained. The amount of mucin and lysozyme protein was measured by immunoblotting. and qualitative RT-PCR was done to investigate the expression of mucin mRNAs and lysozyme mRNA.
RESULTS:
Passage-2 NHNE cells contained 16% of mucin and 76% of lysozyme when compared to the amount of intracellular mucin and lysozyme of normal in vivo nasal epithelial cells. MUC4, MUC5AC, MUC7, MUC8 and lysozyme mRNAs were expressed in passage-2 NHNE cells. However, MUC2 and MUC5B mRNAs were not expressed.
CONCLUSION:
Passage-2 NHNE cells contain enough amount of mucin and lysozyme protein and express most mRNAs of secretory genes which are known to be expressed in the human airway. Thus, we find passage-2 NHNE cells to be suitable for conducting studies on secretions in the human upper airway.
Keywords: Normal human nasal epithelial cellsMucinLysozymeProteinmRNA
서론 기도상피세포는 기도질환들 즉 각종 비염, 부비동염, 만성기관지염, 천식, 낭종섬유증 등에서 인체방어기전의 첫 장소이고 세균의 첫 표적세포들이기에 이의 생리학적 현상에 대한 연구는 매우 중요한 의미를 갖는다고 하겠다. 그러나 지금까지의 대부분의 연구는 기니 픽,1) 쥐,2) 햄스터3) 등의 동물 기도상피세포를 이용하여왔다. 저자들은 사람 정상 코점막 상피세포를 계대배양하여 실험에 사용하기 용이한 충분한 양의, 분화능력을 가지고 있는 많은 냉동 상피세포를 확보할 수 있는 방법을 개발하고 각 계대에서 상피세포의 분비성 분화의 특성을 밝히며 retinoic acid(RA)가 점액과 리소자임 분비에 미치는 영향을 규명하고자 연구를 실시하였다. 연구결과, 세포분화능의 소실없이 성공적으로 계대 배양을 하였으며, passage-4까지 계대배양하여 그 특성을 분석하였는데, passage-2 사람 코점막 상피세포가 생체에서와 같이 점액 및 리소자임 단백질을 분비하고, RA에 의해 세포의 형태가 변화하는 것을 관찰함으로써, 사람 코점막 passage-2 상피세포를 air-liquid interface(ALI)법을 이용하여 분화시키는 방법은 사람 코점막 상피세포의 분화와 분비물들을 연구하는 데 좋은 실험모델로 사용할 수 있음을 보고하였다.4) 이번 연구는, 배양된(passage-2) 사람 코점막 상피세포가 사람 생체 정상 코점막 상피세포 및 하기도(lower airway)인 사람 기관점막 상피세포와 어떤 차이점이 있는 지를 알아보고자, 냉동질소에 보관되어 있는 사람 passage-2 코점막 상피세포들에서 분화를 유도하여 생체에 가깝게 분화를 유도한 후, 세포내에 들어있는 점액과 리소자임 단백질의 양을 측정하고, 현재까지 알려져 있는 9개의 점액 유전자중 MUC1, MUC3 및 MUC6를 제외한 6개의 점액 mRNA와 리소자임 mRNA의 발현정도를 비교하였다. 재료 및 방법 배양된 Passage-2 사람 정상 코점막 상피세포의 수집 및 생체에서 획득한 코점막 상피세포의 수집 반투과성막(Transwell-clear, Costar Corp., Cambridge, MA)에 3.0 mg/ml의 제 1 형 콜라젠젤(Collaborative Res., New Bedford, MA)을 입혀 ammonium hydroxide가 들어 있는 밀폐된 곳에서 굳힌 후, 10 5개의 배양된 인체 정상 코상피세포(normal human nasal epithelial(NHNE) cells, passage-2)를 호르몬과 각종 성장인자가 첨가된 무혈장 배양액4)에 부유하여 평판하였다. 세포들은 첫 9일간은 배양액에 잠긴 상태로 두었으며 ALI를 만드는 9일까지 위 및 아래쪽 부분을 모두 격일로 갈아주었다. 그후 배양액은 아래쪽 부분만 매일 교환해 주었으며 위쪽은 배양액을 제거하여 공기에 노출시켰다. 배양은 37 0C, 5% CO2에서 진행하였다. Transwell-clear membrane에 평판한 후 16일간 배양하여 각각 3 wells로부터 cell lysate와 RNA를 채취하였다. 한편 생체 정상 코점막 상피세포는 코질환의 병력이 없는 20∼30대의 건강한 성인 10명에서 하비갑개 점막을 scraping하여 채취하였으며 섬유아세포, 혈관내피세포 및 근육세포를 없애기 위해 37℃에서 1시간동안 플라스틱 용기에서 배양하여 상피세포만을 얻었으며 trypsin/EDTA로 처리하여 단세포로 만든 후 세포의 수를 측정하였다. 얻어진 세포의 일부는 RNA를 채취하기 위해 Tri-reagent에 넣어 처리하였고 일부는 cell lysate를 만들었다. 사람 기관점막에서 추출한 RNA(human trachea total RNA, Clontech, Palo Alto, CA, USA)는 구입하여 사용하였다. 점액과 리소자임 단백질의 정량 배양된 사람 정상 코점막 상피세포에서 분비물 측정을 위한 방법은 배양세포들이 24시간동안 분비한 양을 수집하여 immunoblot assay를 이용하는 Gray 등5)이 기술한 방법을 사용하여 정량하였다. 또한 배양액중 RA 유무에 따른 점액과 리소자임의 분비량을 측정하였다. 순수 인체점액(a generous gift from Dr. Davis CW, University of North Carolina, NC, USA)과 리소자임(Sigma, St. Louis, MO)을 표준으로 사용하였다. 점액에 대한 일차항체로는 단클론성 항체인 H6C5(1:1,000, a generous gift from Dr. Davis CW)을 리소자임에 대한 일차항체로는 다클론성 리소자임 항체(1:1,000, Dako, Capintera, CA)를 사용하였다. 배양된 세포에서 채취된 분비물과 표준들은 일정한 비율로 희석하여 나이트로셀룰로즈막에 적용하여 일차항체와 반응시킨후 horse-radish peroxidase conjugated goat anti-mouse IgG 혹은 anti-rabbit IgG에 반응시켜 chemiluminescence(ECL kit, Amersham, Buckingamshire, UK)로 발색시켰다. Linear regression analysis를 이용하여 standard curve를 얻은 후 각 검사물의 발색정도와 비교하여 그 양을 정량하였다. 리소자임 항체의 특이성은 Western blot에 의해 확인하였다. 각 그룹에서 배양된 세포들의 수는 세포들을 트립신 처리하여 단세포로 만든 후 hemocytometer로 측정하였다. 배양된 상피세포에서 의 각 실험결과는 같은 실험을 3번이상 시행하여 평균±표준편차로서 나타내었으며 통계학적 처리는 Student's t-test로 하였다. 점액 유전자와 리소자임 mRNA의 측정을 위한 RT-PCR 이번 연구에서 세포막에 부착된 점액인 MUC1과 in situ hybridization에 의해 코점막에 발현되지 않는 것으로 보고된 MUC3과 MUC6는 제외하였다. Oligonucleotide primers는 이미 발표된 유전자 배열에 의거하여 human MUC2(Genbank accession #L21998, 5' primer:TG-CCTGGCCCTGTCTTTG;3' primer:CAGCTCCA-GCATGAGTGC);human MUC4(Genbank accession #AJ000281, 5' primer:TTCTAAGAACCACCAG-ACTCAGAGC;3' primer:GAGACACACCTGGAG-AGAATGAGC);human MUC5AC(Genbank accession #U06711, 5' primer:TCCGGCTCATCTTCTTCC;3' primer:ACTTGGGCACTGGTGCTG);human MUC5B(Genbank accession #Z72496, 5' primer:ACTCCAGAGACTGTCCACAC;3' primer:TACC-ACTGGTCTGTGTGCTA);human MUC7(Genbank accession #L132283, 5' primer:CCACACCTAA-TTCTTCCC;3' primer:CTATTGCTCCACCATGTC);human MUC8(Genbank accession #U14383, 5' primer:ACAGGGTTTCTCCTCATTG;3' primer:CGTTTATTCCAGCACTGTTC);human lysozyme(Genbank accession #J03801, 5' primer:CTCTCAT-TGTTCTGGGGC;3' primer:ACGGACAACCCTC-TTTGC) 등으로 만들어 사용하였다. 각 cDNA크기는 MU C2는 440 bp, MUC4는 466 bp, MUC5AC는 680 bp, MUC5B는 338 bp, MUC7은 209 bp, MUC8은 239 bp, 리소자임은 350 bp이었다. Control gene으로는 β2 micro-globulin을 사용하였으며 350 bp이었다. RT-PCR은 Perkin Elmer Cetus DNA Thermal Cycler를 이용하여 시행하였다. 이미 각 primer에 대한 kinetic study를 시행하여 적절한 MgCl 2 농도는, MUC4, MUC5B, MUC5AC, MUC7, MUC8, 리소자임 및 β2M은 1.5 mM이었으며 MUC2는 2.5 mM이었다. 한편, MUC2, MUC5AC 및 β2M의 annealing temperature는 60℃, MUC4, MU C5B, MUC7, MUC8 및 리소자임은 55℃C였다. 각 유전자에서의 linear range는 MUC2는 29∼35 cycles, MUC5AC는 32∼40 cycles, MUC5B는 23∼29 cycles, MUC7은 32∼40 cycles, MUC8은 32∼38 cycles이었다. 나타난 PCR 산물이 genomic DNA오염이 없었다는 것을 증명하기 위해 RT reaction시 RT enzyme을 없이 시행하여 PCR후에도 아무런 band가 나타나지 않음을 확인하였고 DNA sequencing(dsDNA Cycle Sequencing System, Gibco-BRL) 을 하였다. 결과 점액 및 리소자임 단백질의 정량 점액의 양은 사람 생체 코점막에서 채취한 상피세포에서는 106세포당 814.9 μg이었으며, 배양된 코점막 상피세포에서는 106세포당 131.4±9.1 μg으로 같은 수의 생체 코점막 상피세포가 함유하는 양의 16.1%만을 함유하고 있었다. 한편 리소자임의 양은 사람 생체 코점막에서 채취한 상피세포에서는 106세포당 10 μg이었으며, 배양된 코점막 상피세포에서는 106세포당 7.6±2.3 μg으로 같은 수의 생체 코점막 상피세포가 함유하는 양의 76%를 함유하였다(Table 1). 점액 및 리소자임 유전자의 발현 사람 생체 코점막 상피세포와 사람기관점막에서 추출한 RNA에서는 검사한 모든 점액 및 리소자임 유전자가 발현되었다. 배양된 사람 코점막 상피세포에서는 MUC2 및 MUC5B가 발현되지 않았고 그 외의 점액유전자는 모두 발현되었다. 그 중 MUC4는 배양된 세포에서 오히려 더 강하게 발현되었으며 MUC5AC와 MUC7은 생체 상피세포에서와 배양된 상피세포에서 유사한 정도로 발현되었고 MUC8은 배양된 상피세포에서 약하게 발현되었다. 한편, 리소자임 유전자 역시 배양된 상피세포에서 발현되었으나 그 발현정도가 생체 상피세포보다는 약하였다(Fig. 1). 고찰 인체 passage-2 코점막 상피세포를 이용하여 분화를 유도하였을 경우 RA가 배양액에 있을 때는 점액섬모상피세포로 분화가 되고 RA를 결핍시켰을 때는 편평세포로 분화가 됨은 이미 알려져 있다.5) 그러나 실험실에서 형태학적으로는 점액섬모상피세포로 분화가능하지만 생체에서 관찰되는 코점막 상피세포의 형태와 비교해 볼 때 차이가 있다. 가장 현저한 차이는 가장 분화가 진행된 점액분비세포인 배세포를 관찰할 수 없다는 점이다. 즉 아직까지 실험실에서 분화를 유도한 인체 코점막 상피세포를 성숙된 배세포로 만들 수 없다는 점이 문제점으로 남지만 현재 이보다 효과적인 배양법이 없다는 점과 충분한 수의 세포를 확보할 수 있어 많은 양의 실험을 동시에 수행할 수 있고 점액섬모상피세포로의 분화를 비교적 잘 유도한다는 점 때문에 Yoon 등4)의 방법은 코점막 상피세포의 매우 효과적인 배양 체계라고 할 수 있다. 본 연구의 목적은 Yoon 등의 방법에 의해 가능한 생체와 유사하게 분화를 유도시킨 상피세포에서 점액과 리소자임의 단백질 함유량과 유전자 발현 양상을 생체 코점막 상피세포와 비교하고자 하였다. 저자들의 결과에서 사람 생체 코점막 상피세포는 10 6세포당 약 814.9 μg의 세포내 점액을 함유하고 있었고 배양된 상피세포는 131.4 μg의 세포내 점액을 함유하고 있었다. 이러한 차이는 배양된 상피세포에는 완전히 성숙된 점액분비세포가 관찰되지 않기 때문으로 생각되었으나 배양된 상피세포도 충분한 양의 점액을 함유하고 있다는 것을 나타내고 있다. 한편, Gray 등5)은 배양된 passage-2 인체 기관기관지 상피세포에서 10 6세포당 약 100∼400 μg의 점액을 함유한다고 보고하였는데 이러한 차이 역시 상기도와 하기도에 분포하는 배세포의 양의 차이에 기인할 것으로 사료되었다. 다음 단계로 점액성 분비물의 대표격인 점액유전자와 장액성 분비물의 하나인 리소자임 유전자의 발현을 RT-PCR을 이용하여 조사하였다. 본 연구에서 Northern blotting을 사용하지 않고 RT-PCR을 이용한 이유는 점액유전자는 Northern blot을 하면 일부 점액유전자는 band 크기를 알 수 없게 길게 늘어나 보이는 smear현상이 나타나며6) 리소자임은 mRNA의 양이 적어 약 2주간 cassette에 넣어 두어도 신호의 강도가 매우 미약하였기 때문에 결과에 신뢰성을 두기가 어려웠기 때문이다.7) 현재까지 점액유전자는 MUC1부터 MUC8까지 9개의 점액유전자가 보고되어 있으며 리소자임은 인체에 지금까지 단 1개의 유전자만이 보고되어 있다. 또한 본 연구에서는 점액유전자중 기도에서는 발현이 되지 않는다고 보고되는 MUC3와 MUC6, 세포막에 부착되어 있는 점액인 MUC1은 제외하였으며 상기도와 하기도에서의 유전자발현의 차이를 관찰하기 위해 사람 기관에서 추출한 RNA를 사용하였다. 상기도인 사람 생체 코점막 상피세포에서 추출한 RNA와 하기도인 기관에서 추출한 RNA에서는 검사한 모든 점액유전자가 모두 발현이 되었는데, in situ hybridization방법을 이용한 연구에서8)9) 점액성 분비세포에서 발현이 되는 것으로 알려져 있는 MUC2와 MUC5AC는 사람 생체 코점막 상피세포와 기관 상피세포에서 동일한 정도로 나타났는 데 이는 배세포의 분포정도가 비슷함을 암시한다고 할 수 있다. 그러나 사람 생체 코점막 상피세포에서 MUC8이 기관 상피세포에서 보다 더 강하게 발현이 되었다. MUC5B와 MUC7은 주로 점막하 선조직에서 발현이 되며 그중 MUC5B는 점액성 분비세포에, MUC7은 장액성 분비세포에 발현이 된다고 알려져 있다.10) MUC5B는 생체 코점막 상피세포와 기관 상피세포에서 유사한 정도로 발현이 된 반면, MUC7 은 생체 코점막 상피세포에서 오히려 발현이 적게 되었다. MUC4는 표면 상피층에서 주로 발현이 된다고 알려져 있으며 본 연구에서는 생체 코점막 상피세포에서 MUC4가 기관 상피세포에서 보다 발현이 조금 덜 되었다. 이러한 결과는 현재로서는 해석하기가 어렵고 각종 질환에서의 병적상태와의 비교 등의 더 많은 연구가 진행되어야 할 것으로 생각된다. 한편 배양된 passage-2 코점막 상피세포에서는 생체 정상 코점막 상피세포와 비교할 때, MUC2 와 MUC5B가 발현이 거의 되지 않았으나 나머지 점액유전자는 모두 발현이 됨으로써 배양된 passage-2 코점막 상피세포가 점액유전자의 분비조절기전을 연구하는데 이용될 수 있을 것으로 사료된다. 리소자임 유전자는 생체 코점막 상피세포와 기관점막 상피세포에서 유사한 정도로 발현이 되었으나 배양된 passage-2 코점막 상피세포에서는 생체에서 채취한 코점막 상피세포에서 보다 발현이 훨씬 적었다. 이 결과를 리소자임 단백질과 비교해 보면, 리소자임 단백질은 의미있는 차이가 없었는데 불구하고 리소자임 유전자는 현저한 차이가 있는 불일치 현상이 나타났다. 저자들의 이전의 연구에서 역시 리소자임이 단백질과 유전자사이에 레티노익산 유무에 따라 불일치현상을 보였는데11) 이와 유관할 것으로 사료된다. 결론 결론적으로 배양된 passage-2 코점막 상피세포는 대부분의 점액유전자와 리소자임 유전자를 발현하고 또한 단백질도 분비하는 것을 관찰함으로써 상피세포의 분비조절기전을 연구하는 데 좋은 도구로서 생각된다.
REFERENCES
1) Adler KB, Cheng PW, Kim KC. Characterization of guinea pig tracheal epithelial cells maintained inbiphasic organotypic culture: Cellular composition and biochemical analysis of released glycoconjugates. Am J Respir Cell Mol Biol 1990;2:145-54. 2) Kaartinen L, Nettesheim P, Adler KB, Randel SH. Rat tracheal epithelial cell differentiation in vitro. In Vitro Cell Dev Biol 1993;29A:481-92. 3) Niles R, Kim KC, Hyman B, Christensen T, Wasano K, Brody J. Characterization of extended primary and secondary cultures of hamster tracheal epithelial cells. In Vitro Cell Dev Biol 1988;24:457-63. 4) Yoon JH, Kim KS, Kim SS, Lee JG, Park IY. Secretory Differentiation of Serially Passaged Normal Human Nasal Epithelial (NHNE) Cells. Kor J Otolaryngol 1998;41:1008-14. 5) Gray T, Guzman K, Davis CW, Abdullah L, Nettesheim P. Mucociliary differentiation of serially passaged normal human tracheobronchial epithelial cells. Am J Respir Cell Mol Biol 1996;14:104-12. 6) Guzman K, Gray T, Yoon JH, Nettesheim P. Quantitation of mucin RNA by PCR reveals induction of both MUC2 and MUC5AC mRNA levels by retinoids. Am J Physiol 1996;271 (Lung Cell Mol Physiol 15) :L1023-L1028. 7) Yoon JH, Gray T, Guzman K, Koo JS, Nettesheim P. Regulation of the secretory phenotype of human airway epithelium by retinoic acid, triiodothyronine, and extracellular matrix. Am J Respir Cell Mol Biol 1997;16:724-31. 8) Aust MR, Madson CS, Jennings A, Kasperbauer JL, Gendler SJ. Mucin mRNA expression in normal and vasomotor inferior turbinates. Am J Rhinol 1997;301:293-302. 9) Reid CJ, Gould S, Harris A. Developmental expression of mucin genes in the human respiratory tract. Am J Respir Cell Mol Biol 1997;17:592-8. 10) Sharma P, Dudus L, Nielson PA, Clausen H, Yankaskas JR, Hollingsworth MA, et al. MUC5B and MUC7 are differentially expressed in mucous and serous cells of submucosal glands in human bronchial airways. Am J Respir Cell Mol Biol 1998;19:30-7. 11) Yoon JH, Koo JS, Norford D, Guzman K, Gray T, Nettesheim P. Lysozyme expression during metaplastic squamous differentiation of retinoic acid-deficient human tracheobronchial epithelial cells. Am J Respir Cell Mol Biol (in press).
Editorial Office
Korean Society of Otorhinolaryngology-Head and Neck Surgery
103-307 67 Seobinggo-ro, Yongsan-gu, Seoul 04385, Korea
TEL: +82-2-3487-6602    FAX: +82-2-3487-6603   E-mail: kjorl@korl.or.kr
About |  Browse Articles |  Current Issue |  For Authors and Reviewers
Copyright © Korean Society of Otolaryngology-Head and Neck Surgery. All rights reserved.                 developed in m2community
Close layer
prev next